Al inicio de la Era del Gene

Como un padre orgulloso de dos buenos hijos, ocasionalmente me encuentro atribuyéndole a mi esposa o a mí mismo las características vistas en ellos. “Sus temperamentos vienen de su madre, y su sentido del humor lo tienen de mí”. Sin lugar a dudas, nuestros hijos heredaron alguna combinación del material genético de sus padres, pero también nosotros hemos heredado nuestros genes, buenos, malos o indiferentes, de nuestros padres; ellos, a su vez, de sus padres, y así sucesivamente.

Aunque siempre ha habido interés por la genética, sólo en años recientes el estudio de la misma pareciera dominar sobre todas las ciencias biológicas.

La genética también se ha convertido en parte del dominio público. Desempeña un papel importante en numerosos y diversos campos como en los juicios criminales, en la identificación de la gente y en el estudio de las enfermedades. De vez en cuando, las noticias informan acerca de la relación de un gene con alguna enfermedad en particular, abriendo la posibilidad de encontrar una cura de la misma. Hace alrededor de un año, se informó que un gene estaba implicado en el síndrome de Werner, una condición en la cual personas de 20 años desarrollan canas y achaques que son comunes solamente entre la gente mayor. Se pensaba que este gene era el “santo Grial” de la investigación relacionada con el envejecimiento. Si el eslabón es correcto, habría esperanza de que el envejecimiento pueda ser tratado en el futuro como se hace con la enfermedad en general.

El descubrimiento de nuevos genes implica la posibilidad de curar enfermedades de origen genético. Como resultado de ello hemos creado el “Proyecto Humano Genético”, que significa para el campo de la biología lo que fue la aventura de la NASA de enviar al hombre a la luna. A pesar de que esta empresa costará muchos millones de dólares cada año, se esperan resultados tan espectaculares como el primer paso humano sobre la luna, y probablemente de más utilidad. Podríamos estar encaminándonos ya hacia la “Era del Gene”.

¿Qué son los genes?

En primer lugar, ¿qué son los genes? ¿Qué papel desempeñan en la función de los organismos? Los genes constituyen segmentos de cromosomas que producen proteínas específicas. Cada uno de los 100.000 genes que poseemos aproximadamente, contiene la información necesaria para la estructura correcta de una proteína. Nuestros genes están distribuidos entre 23 pares de cromosomas. Una persona hereda 23 cromosomas de la madre y 23 del padre. Por lo tanto, tenemos dos copias de cada uno de nuestros genes. Una excepción consiste en los genes que se encuentran en los cromosomas que determinan el género masculino, llamado “Y”. De estos, el hombre tiene solamente una copia y las mujeres ninguna. Tanto los genes como sus proteínas correspondientes, pueden ser representadas como perlas ensartadas en un hilo. Las perlas que representan a los cromosomas tienen cuatro colores diferentes, mientras que las perlas que representan a las proteínas tienen veinte. Los diferentes “colores” representan diferentes estructuras químicas. Las perlas que representan a los cromosomas se llaman “desoxyrribonucle-ótidos” (abreviadas aquí como “nucleótidos”), y las perlas de proteínas son los “amino-ácidos”. Una compleja máquina traductora dentro de la célula interpreta tres nucleótidos en fila en un gene como un aminoácido específico en la proteína correspondiente. Una cadena de 300 perlas de cromosomas codifican 100 aminoácidos en la proteína del gene. Las proteínas típicas pueden llegar a tener varios centenares de aminoácidos. La secuencia de los nucleótidos en el gene determina el orden de los aminoácidos en la cadena proteica. Ver la ilustración No.1.

De la manera en que la ortografía determina el significado de las palabras, el orden de los aminoácidos determina la función de las proteínas individuales. Así como la ortografía incorrecta en una palabra puede causar la pérdida del significado de la misma, el orden de los aminoácidos en una proteína puede resultar en la pérdida de su función. Un gene alterado, o lo que se entiende por una mutación, es la causa más común para que se presente el orden incorrecto del aminoácido. Un gene que ha tenido mutación perpetúa la producción de proteínas defectuosas que a menudo se transmiten a las generaciones futuras. ¿Cuán serio es el problema de tener las proteínas incorrectas? El problema resulta crítico al considerar el largo alcance de la función asignada a estas sustancias. Cada cambio químico en el cuerpo depende de la presencia de las proteínas catalíticas específicas. Las proteínas forman en gran parte la estructura física de la materia viva y participan en el transporte del oxígeno y de otros nutrientes en la sangre. El sistema inmune emplea proteínas llamadas “anticuerpos” para defenderse de sustancias extrañas. Cuando las células se comunican entre sí, es la proteína “receptora” la que reconoce las señales químicas.

Las proteínas defectuosas causan una hueste de enfermedades. Hasta hace poco, el único recurso que tenían los médicos y los pacientes para combatir las enfermedades heredadas genéticamente era el de controlar el daño, es decir, tratar de minimizar las consecuencias negativas de una proteína defectuosa. Por ejemplo, en el caso de la enfermedad conocida como fenilketonuria, el infante no puede metabolizar el aminoácido esencial conocido como fenilalanina. El niño acumula sustancias tóxicas de estos aminoácidos, que trae como consecuencia el retardo mental. Los bebés en los Estados Unidos, son examinados como rutina, poco después de su nacimiento, para la detección de este defecto metabólico. Si el examen arroja resultados positivos, se altera la dieta del bebé de tal forma que excluya, en la mayor medida posible, los aminoácidos dañinos. Sería mucho mejor si pudiéramos corregir este defecto genético reparando el gene defectuoso o reemplazándolo por uno que funcione correctamente.

Los avances en la genética

En las últimas dos décadas se han visto verdaderos avances en nuestra capacidad para manejar el material genético. A principios de los años 50 ya se sabía que la composición química de los genes era el ácido desoxirribo-nucleico o ADN, que consiste de repetitivas unidades de cuatro tipos de nucleótidos. Si se pudiera representar sobre papel en forma simple una estructura tal empleando las abreviaturas A,T,G y C para los cuatro nu-cleótidos, tendríamos uno a más libros llenos de líneas similares a la siguiente (el orden de los nucleótidos variaría continuamente):

—ACTGGTTAGTTCCAGTCATGAGGTCCAATATAGATCAGTACGATTTAAGGCAT—

Esta monotonía estructural impidió que los científicos segmentaran el ADN en fragmentos más pequeños que se pueden manipular, de una composición más uniforme y que pudieran determinar el orden de los nucleótidos. El avance en el conocimiento vino con el descubrimiento de las “enzimas restringentes” de las bacterias. Estas asombrosas proteínas aparentemente pueden reconocer secuencias de cortos segmentos de nucleótidos especiales del ADN y dividirlo en un lugar en particular. Por lo tanto, tenemos actualmente medios de obtener fragmentos más pequeños del ADN, de composición uniforme.

También se encontraron otros cataliza-dores (enzimas) que tenían la capacidad de empalmar fragmentos del ADN. Estos descubrimientos pavimentaron el camino para llegar hasta donde nos encontramos hoy en día: tenemos la capacidad de manejar genes individuales, de introducir genes de un organismo dentro de otro, de recombinar porciones de genes diferentes en el tubo de ensayo y de determinar el orden de sus nucleótidos.

El Proyecto Genético Humano, lanzado en 1988, trata de determinar las secuencias de los nucleótidos de los 24 cromosomas humanos, que se estima contienen aproximadamente tres mil millones de nucleótidos y de localizar los 100.000 genes dentro de estas secuencias. (Hay dos cromosomas diferentes que determinanan el sexo, llamados “X” e “Y”. El hombre tiene un par X-Y y la mujer un par X-X, además de los otros 22 pares de cromosomas.) Los nucleótidos de los 100.000 genes constituyen aproximadamente dos por ciento del material genético humano. Se desconoce casi en su totalidad lo que hace el otro 98 por ciento del ADN humano. Sin embargo, ya que los genes de todos los seres humanos son relativamente similares, las diferencias obvias entre los individuos tiene que venir del 98 por ciento restante del material genético. Uno de los factores controlados por estas porciones del material genético es la cantidad de proteína que se produce. Bajo cualquier circunstancia se puede asumir que estas porciones “no genéticas” también son importantes para nuestro bienestar.

El orden de los nucleótidos

Ya ha sido determinado el orden exacto de los nucleótidos en unos pocos organismos menos complicados. En la primavera de 1996, ya se habían determinado las secuencias completas de la bacteria Hemophilus influenza (1.8 millones de nucleótidos) y de la levadura (13 millones de nucleótidos). Debido a su tamaño, pasarán algunos años antes de que se conozca el orden completo de los nucleótidos del gene humano en su totalidad. ¿Pero, de quiénes serán las secuencias de los nucleótidos? Sabemos que, con excepción de los gemelos idénticos, nos diferenciamos uno del otro en un promedio de un nucleótido por cada mil (0,1%), en la porción que corresponde a nuestro gene que no es de naturaleza genética. El Proyecto Genético Humano emplea el material genético de una población relativamente pequeña de ascendencia norteamericana o europea. Este pequeño gene compuesto llegará a ser el primer “patrón” que servirá de comparación para el resto de la población. Pasará mucho tiempo antes de que se haya experimentado suficientemente como para adquirir un buen entendimiento de la naturaleza de las variaciones del material genético humano.

Los problemas de los estudios genéticos

Hay una preocupación, legítima por cierto, de que llegue el día en que se considere a los individuos cuyo perfil genético cae fuera del “patrón” como seres humanos de segunda clase. La sociedad puede inclusive decidir un día que la gente con “genes malos”, constituye una amenaza a largo plazo para el bienestar de la humanidad.

Ya existen “pruebas” químicas para encontrar indicios genéticos para identificar enfermedades de este origen, tales como el Alzheimer, o ciertas formas de cáncer del seno y del colon. Algunos patrones aberrantes particulares en las secuencias de los nucleótidos parecen tener correlación con un factor de riesgo creciente de estas enfermedades. Para aquellos que poseen ese factor, un conocimiento anticipado del mismo puede facilitar una advertencia para intervenir con prácticas preventivas.

Por otro lado, si la compañía de seguros o la empresa que los emplea descubren en estas personas esos factores de riesgo, pueden correr el riesgo de ser despedidos del empleo o de perder el seguro de salud. De allí que sea tan importante mantener en privado la información genética de las personas. Con la excusa de querer proteger el bienestar de la sociedad, ¿hasta dónde llegarán los intrusos a examinar nuestra más íntima posesión, a saber, nuestro “mapa” genético? Las personas que hereden genes causantes de enfermedades tendrían razones para estar amargadas. ¿Por qué deben sufrir por algo que ellas no causaron? ¿Pero no es cierto también que todos somos prisioneros de nuestros propios genes? Si los genes determinan nuestra personalidad y nuestra inteligencia, ¿no controlan, en gran medida, la calidad de nuestra vida?

La respuesta es “no”. Aunque muchos de nuestros atributos físicos y las características básicas de nuestra personalidad son controlados genéticamente, hay evidencia abundante de que el medio ambiente, el estilo de vida y la dieta son considerables determinantes de nuestro bienestar físico y mental. Lo que leemos, escuchamos, vemos, sentimos y pensamos, afecta nuestra vida. Tenemos el poder de controlar y modificar nuestro ánimo, nuestros pensamientos y nuestras acciones. No somos entidades estáticas, sino que estamos en continuo cambio. Así como nuestros sentidos clasifican el medio ambiente e informan sus descubrimientos a nuestro sistema nervioso central, constantemente nuestro cerebro registra la nueva información y modifica todo lo demás que ya está allí registrado allí. El punto más importante a saber es que nuestro mapa genético no es alterado por lo que almacenamos en nuestro cerebro. Es el contenido de nuestro cerebro el que define quiénes somos.

Otra preocupación dentro de los estudios genéticos es la suposición de la sociobiología de que todo lo que sucede en la biología es para el beneficio del mapa genético. Esta teoría asume que los genes precedieron a todo lo demás y que de alguna manera creó el mundo biológico con el objeto de mantener y de mejorar el mapa genético. Esta forma de determinismo biológico sirve de base para que algunos científicos formulen una gran “teoría unificada”, la cual les explica a ellos el por qué las cosas son como son.

Los estudios genéticos y la evolución

Lo que esta teoría, y otras basadas en la evolución omiten en contestar, es de dónde proviene el contenido informativo del gene. Es muy difícil negar que hay información biológica que reside en el gene. Se calcula que un micrómetro cúbico de ADN puede codificar 150 megabytes de información. Esto supera en 10 órdenes de magnitud a la capacidad de almacenamiento óptico de los C- ROM corrientes. Si la secuencia completa del nucleótido de la bacteria común del colon, Escherichia coli se imprimiera en forma de libro, éste tendría unas 3.000 páginas. Un documento similar que reflejara el contenido informativo del gene humano formaría una biblioteca de 1.000 volúmenes de 3.000 páginas cada uno.

Hace una generación, los teóricos de la teoría de la evolución estaban muy ocupados describiendo un mundo hipotético primordial “prebiótico”, del cual los primeros organismos vivos habrían emergido de componentes no vivientes. Una de las deficiencias de estos esquemas químicos de evolución es la incapacidad de demostrar cómo llegaron a existir los ácidos nucleico. Entre los obstáculos se incluye el desafío de explicar la formación de los cinco compuestos del indispensable carbón-azúcar, D-2-desoxirribosa en cantidades apreciables, la síntesis de los cuatro desoxirribonucle-ótidos diferentes y su interconexión en secuencias apropiadas. Pero un desafío más grande y formidable que no ha sido resuelto por estos científicos, es el de explicar la procedencia de la fuente de información biológica que reside en el mapa genético de cada organismo.

El gene contiene datos directos para la estructura correcta de cada proteína del organismo, y para la regulación del tiempo y cantidad de su producción. Indirectamente, por las acciones de las proteínas, cada aspecto del metabolismo y de la infraestructura del organismo está codificado en el gene. El nivel de sofisticación de la ingeniería y de la bioquímica visto en la materia viviente, excede por mucho cualquier proceso observado en nuestras mejores plantas de producción química.

¿Es la investigación genética un área prohibida?

Los creyentes en la Biblia reconocerán sin dilación sobre el gene la firma misma del Creador, quien llamó a la existencia al universo entero. Sin embargo, ahora que podemos manipular los genes en el tubo de ensayo, ¿deberíamos sentir preocupación por estar incursionando en un terreno prohibido por el Creador?

Si uno ve al gene como un componente de la materia viviente funcional, y no como una “sustancia maestra”, entonces las preocupaciones expresadas en forma específica concernientes a la investigación científica del gene, podrían ampliarse para incluir todos los ámbitos de la investigación dentro de la biología. El registro bíblico cita al Creador al dirigirse a los primeros humanos diciendo: “Fructificad y multiplicaos; llenad la tierra, y sojuzgadla” (Génesis 1:28 RVR, 1960). Toda investigación biológica puede entrar en la categoría de “sojuzgar a la creación”, ya que el entender la naturaleza es un requisito para su utilización eficiente.

Los genes, en particular, ya habían sido manipulados desde tiempos inmemoriales a través de la cría y la reproducción selectiva. Siempre que el nuevo conocimiento obtenido por medio de la investigación científica se emplee para promover la salud y el bienestar del individuo y del grupo, podemos estar seguros de que se encuentra dentro de los parámetros bíblicos. Por el contrario, la investigación científica dirigida a la explotación de los sistemas biológicos con propósitos destructivos nos coloca en un curso de colisión directa con el Creador. Al estar a punto de entrar en la Era del Gene, nos enfrentamos con problemáticas no diferentes a las que tuvimos cuando entramos en la era atómica. La pregunta es: ¿Hemos llegado a ser más sabios ahora?

George T. Javor (Ph.D., Columbia University) enseña bioquímica en la Universidad Loma Linda. Ha publicado artículos relacionados con los aspectos de la fisiología bacteriana del organismo Escherichia coli, basado en razones bioquímicas en favor del creacionismo, y los libros Erase una vez una molécula y El desafío del cáncer. Su dirección postal es: Loma Linda University School of Medicine; Loma Linda, California 92350; E.U. A. E-mail: INTERNET: gjavor@ccmail.llu.edu